Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D010E01
Clone ID D010E01
Vector rFlpROSAbetageo
Project ggtc

Sequence tag D010E01
Sequence
CAACACACCACAANACCGATCCCGCACCGAACCCACAACNNGNNACCCCCACCACTCAGCCCNNCCCATCTACACNNNNA
GCCNNCCCCCCACCACNGACNNCAAGGCCCACACAAACACATCNNCACAACCCACACCCCNNACACAAAANNCCAAAACC
AGCACCCNNCCNNAACCCTCGCCACNNTCAACCCAAACCACCCAGCCAGAANAGCCACCGCCCAACNNACCACAACGATC
TAGCAACAAACTCAAAAGCAGCACCAGCTTCACAAACTAAGGTAGCCGAGGAGACTGAAGAGATTAGTTCGAATANNNCG
TTGGTCAAAGCAGATGAGCTGGATAAGCCTAGAGAATCAGAAAAGGTGAAGATTACCAAGGTGTTTNNNTTCGCTGGCGA
AGAAGTAAGGGTGACTAAGGAAGTAGATGCTGCGTCTAAGGAAGCGAAGTCTTTCCTCAAGCAAACAGAGAGAGAAAANN
NGCAGGCTCTTGTCACTTCACCAGCGACACCACTCCCTGCTGGGTCAGG
Sequence Type mRNA
Unitrap ID UNI9019

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114354770..114365730 119
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031954 (Cfdp1) NM_011801 craniofacial development protein 1 Gene [Source:MGI Symbol;Acc:MGI:1344403]


SPLK-Sequence tag 5SD010E01
Sequence
GATCCAGTAGGTAATTGAGCATTACTTCCTTAGAGAACTTATCTGTGTATTTGAAGCCAGCTGACTAGTCTACTGAGGTT
GATCAGCAACCGTCGTGTAAGCACGGATGTGTTCCCAGCCCTCAGTGTAAGACAGCCATGTGCACACACACACACAAGTG
GTGCTGCCACTGGAGTGGTGAGTCTTACTCACTAGGTTCTTAGTCCTTGTCGCTCTCTAGACTGAAGTCTCGGAGCTGTT
GTTGTGGGCCTCTTGGATTTTACAGTAGAGGGAAGAGTATGGTGTTGCTGCTTCCTTTGAAGAAGAAGGGAG
Sequence Type genomic DNA
Unitrap ID UNI9019

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114339702..114340014 309
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031954 (Cfdp1) NM_011801 craniofacial development protein 1 Gene [Source:MGI Symbol;Acc:MGI:1344403]


SPLK-Sequence tag 3SD010E01
Sequence
TTTTGTGCTTGGACTGGATAGACTTGGCTGGTTCAACTTCGCTTGATTTCTTAGATGAAAAGATGAACTCATAACTCCTA
GCATCCTAGAACTGTTGTGAGAGTAAAATGAGATAGAGTATCGTCGTACCCATTCTGGTCCAGACGCACTCAATAC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000031954


For any suggestions or comments, please send an email to unitrap@crg.es