Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13505D1
Clone ID IST13505D1
Vector VICTR74
Project tigm

Sequence tag IST13505D1HMF1
Sequence
TGTCAAGCAAGCCGCTTCAACTCANAGAGATCTCCTGTCTCTACTTCCCAAGTGCTGAAATTCAAGGAGAGTGCTGCTGC
CGCCACCACACCTGGGCACAGACTTTAATCTTGTACTGAATGAAGATGTGAAAGGCAAACTTGGTCTTTTTTGTAACATT
TATTTTGACGAGTGGTTC
Sequence Type genomic DNA
Unitrap ID UNI2675

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 112337227..112337403 175
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000003604 (Aven) NM_028844 apoptosis, caspase activation inhibitor Gene [Source:MGI (curated);Acc:Aven-001]

 
Come back to gene ENSMUSG00000003604


For any suggestions or comments, please send an email to unitrap@crg.es