Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10271A4
Clone ID IST10271A4
Vector VICTR76
Project tigm

Sequence tag IST10271A4HMF1
Sequence
GAAGGGTGTTTTAGTTTGCTTTCAATTGGTGTGACAAACACCCTGACCAAAATCAAGATGGGGAGGATGCATTACAGTCC
CTTATCAGGGGAAGCTGAGGCAGGAACTAAAACCACCCAGGACCACCTGCTGGGCCAATCATCCATCAAGAAAATGCTCC
GCAGACTGGCCTATAGGCAGCCTGATGGAGGTTAGTTTCTCCCATTGAGTTTCTTCTCTCTAGATAACTAATTTATGATA
NGTTGGCAAAAACCAAACCNNAACAACAGGGCACGGCAGCACACTGTCGCTTTAGTATAGGATTTGTTTTCCTGTTGGTA
ATTTTTGTTTGCATGGTCCAGTTTCTCTCTGTGTTCAGGAATGAGTATCTCCATGGCGGTTTTCATGGACCTGGTGTGGA
ACACTCTTGCTCCTCTCCNNCCATGACTGGTGGCTGGTGCTGAACAGT
Sequence Type genomic DNA
Unitrap ID UNI21596

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 82904060..82904506 437
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038172 (Ttc39b) NM_027238 tetratricopeptide repeat domain 39B Gene [Source:MGI Symbol;Acc:MGI:1917113]


Sequence tag IST10271A4BBF1
Sequence
NAAGGGTGTTTTAGTTTGCTTTCAATTGGTGTGACAAACACCCTGACCAAAATCAAGATGGGGAGGATGCATTACAGTCC
CTTATCAGGGGAAGCTGAGGCAGGAACTAAAACCACCCAGGACCACCTGCTGGGCCAATCATCCATCAAGAAAATGCTCC
GCAGACTGGCCTATAGGCAGCCTGATGGAGGTTAGTTTCTCCCATTGAGTTTCTTCTCTCTAGATAACTAATTTATGATA
GGTTGGCAAAAACCANACCANAACAACAGGGCACGGCAGCACACTGTCGCTTTANTATANGATTTGTTTTCCTGTTGGTA
ATTTTTGTTTGCATGGNCCAGTTTCTCTCTGTGTTCANGAATGAGTATCTCCATGGCGGTTTTCATGGACCTGGTGTGGA
ACACTCTTGCTCCTCTCCTNCCATGACTGGTGGCTGGTGCTGAACAGT
Sequence Type genomic DNA
Unitrap ID UNI21596

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 82904060..82904505 432
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038172 (Ttc39b) NM_027238 tetratricopeptide repeat domain 39B Gene [Source:MGI Symbol;Acc:MGI:1917113]

 
Come back to gene ENSMUSG00000038172


For any suggestions or comments, please send an email to unitrap@crg.es