Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D014D11
Clone ID D014D11
Vector rFlpROSAbetageo
Project ggtc

Sequence tag D014D11
Sequence
GGATCCAANNNCACACAGTTAATTGAAATGTTGCATGCAGACATGAGTGTGCCCTTTCCAGAGGGATTTGTAATCGCAAA
TGACGTGGACAACAAGCGCTGCTATCTGCTCGTCCATCAGGCCAAAAGGTTGAGCAGTCCCTGCATCATGGTGGTAAACC
ATGACGCATCCAGCATACCTAGACTTACAGTAGATGTGGACGGAAGGAAAGAGATTCTCTTCTATGATCGAATTTTATGT
GATGTCCCTTGCAGTGGCGATGGCACAATGAGAAAAAACATTGATGTCTGGAAGAAATGGACAACCTTAAACCACTTGCA
GCTCCATGG
Sequence Type mRNA
Unitrap ID UNI10691

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 69757008..69760557 196
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021595 (Nsun2) NM_145354 NOL1/NOP2/Sun domain family member 2 Gene [Source:MGI (curated);Acc:Nsun2-002]


SPLK-Sequence tag 5SD014D11
Sequence
TAAATAAGAAAATAAGTAAGGCATAGTAACAGCTACTTTTTATGCTGTCATGATGCACATTTATCTGCCTTCTATGCCCA
TTTCACCGTGGACTTCTCATGGTAGCGTCTGTCATGGTTTGTGTGAGGCAGTATTGGTGTGTGGCGTACTTATTCTTCCT
GTTGTTTA
Sequence Type genomic DNA
Unitrap ID UNI29945

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 69761217..69761384 166
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021595 (Nsun2) NM_145354 NOL1/NOP2/Sun domain family member 2 Gene [Source:MGI (curated);Acc:Nsun2-002]


SPLK-Sequence tag 3SD014D11
Sequence
ATGCTCGTAACTGCTGAGTCATCTTTCCAGACCCTCCCTCCCTTCACAGCGTTCTCTTTGGCTCTTTCTATAGAGCTTTA
GTGTTCATTTTTTCTTTTAACATGAAAAGCACAAGCTCTTCAGTGAGTGGGCTAGTATACTAGTATAAACTGACTACAAA
TAATTTAGCAAGTACTTTGTTTATTAAATACTACTAGTTTTATAAAATGGAGGAAAGGTTTTATATTTTTCACAGGAAAA
CTACATAATTCAATAAATTTGGAGATTTTTTTAGTAGAGAAATTCTCCAAATACGTTATAGTTTTTTTGTTAAACTGTTG
GGAAACAGAACAGAACAAAATAAAAAATAGATGTTGGAACAAACATACAGCTTATATAAGGTTACATTAAATTCACTTGC
AACCCTGAGAGGTGTTTGCTTTGTTTTTATTATAAAAGTGCCATAAAAATCATGTTTGTAACGGAGTAAGTAGGTGTTCT
GTGGCCTCTGGTCTGGGGCTGATGTGTTAACCTGAG
Sequence Type genomic DNA
Unitrap ID UNI29945

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 69761513..69762028 508
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021595 (Nsun2) NM_145354 NOL1/NOP2/Sun domain family member 2 Gene [Source:MGI (curated);Acc:Nsun2-002]

 
Come back to gene ENSMUSG00000021595


For any suggestions or comments, please send an email to unitrap@crg.es