Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11528D1
Clone ID IST11528D1
Vector VICTR76
Project tigm

Sequence tag IST11528D1HMR1
Sequence
GCTTAATCCTAATGTGTGAAGAATTGCATATCTCAATCCTAAATTCCAGACCTTTAAGAGCCTGGAGCCTTAAGGCTTAG
GAGCTTGACCTAAGGCCCTTGTGTATTAAGTCCAAAATATTGCTCTTTCCCTTAANCCAGGATTACCATTAGGAGAAGTG
GCAATGGTCTGTGGCTANGGCTTTTGGGGATGANAAGCTC
Sequence Type genomic DNA
Unitrap ID UNI14331

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 177107961..177108159 193
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078868 (OTTMUSG00000016580) predicted gene, OTTMUSG00000016580 Gene [Source:MGI Symbol;Acc:MGI:3652251]


Sequence tag IST11528D1HMF1
Sequence
GTCCTGCCCTGGAGGAAAAACTATGCTTTTTCCATGAAGGAAAACGGATCTTTATGGCACACCAGGCCTTAAGGTTGGTT
GTGGCCCTATAATGCCATTGTGAGTAGCTTGTTAGGGGGCTGTTCTTTGATATCAGCATAGGTCTAATGCCTGACTGTAT
AGCAGATGTGTCCCTTTTGTTATGGTTTGGAGACAAATTTNTGATNACCCTGGTAAATAANCATGCATATGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 177108227..177108458 222
NO GENE  

 
Come back to gene ENSMUSG00000078868


For any suggestions or comments, please send an email to unitrap@crg.es