Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D015D05
Clone ID D015D05
Vector rFlpROSAbetageo
Project ggtc

Sequence tag D015D05
Sequence
GATGGATGATTTGGAATTGATAGGATTAGACTATCTTTGGAGAGTTGTAATTCAGAGTAATGATGATATTGCCTGCCGAG
CTATTGATCTCCTTAAAGAGATATACACAAACCTTGGTCCAAGGCTGCAGGTCAATCAGGTGGTGATCCATGAAGACTTC
ATTCAGTCTTGCTTTGATCGTTTGAAAGCCTCTTATGACACATTGTGTGTTTTGGATGGTGACAAAGACAGTATTAATTG
TGCAAGACAGGAAGCTGTTCGAATGGTCCGAGTGTTAACTGTTCTAAGAGAATATATAAATGAATGTGACAGTGATTATC
ATGAAGAAAGAACAATTTTGCCTATGTCAAG
Sequence Type mRNA
Unitrap ID UNI10938

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 12700594..12702733 214
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031010 (Usp9x) NM_009481 ubiquitin specific peptidase 9, X chromosome Gene [Source:MGI (curated);Acc:Usp9x-001]


SPLK-Sequence tag 5SD015D05
Sequence
GGTCCTTATTTTTCATGCTTGTAAACCAAGCACTCTTAAACCACTGATACATCCCTTCAGTTTCACTTTTTATACTCATT
TATACTGTTAAACCTTATA
Sequence Type genomic DNA
Unitrap ID UNI10938

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 12703750..12703848 99
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031010 (Usp9x) NM_009481 ubiquitin specific peptidase 9, X chromosome Gene [Source:MGI (curated);Acc:Usp9x-001]


SPLK-Sequence tag 3SD015D05
Sequence
CGCTATCTCAAATCAACAACAAACTCACTTGACAGGCAACCAGGGTAGCTAAAACATAATTTCAAAGAGTTGAATTGTAT
TTCTTTTAAGGTCTTACCATTTAGTAATTCAAATGATATTTATGTTAAGTTCTTTCTTGATGATATAAATTCATTTTTTG
TATCATACTTTCAAGATAAAATGTCAACATAATGTAGTTTTGAATGACTTGATGTTAAGAGCTTTTTGGGCAATT
Sequence Type genomic DNA
Unitrap ID UNI10938

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 12704211..12704445 235
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031010 (Usp9x) NM_009481 ubiquitin specific peptidase 9, X chromosome Gene [Source:MGI (curated);Acc:Usp9x-001]

 
Come back to gene ENSMUSG00000031010


For any suggestions or comments, please send an email to unitrap@crg.es