Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12416E3
Clone ID IST12416E3
Vector VICTR76
Project tigm

Sequence tag IST12416E3HMF1
Sequence
ATAGAATTGGAATTCTAATATTANACTGTGTATTATAGTATCTCTGCCCTTGATCTTTCTTTGATTTATTCTGAGAATCA
GGGCATAAATATAAGAGGGCAAGGTAGCTGGCCTTTTATTATTTTTTTTTATTTTTTTGCTTTTTTTCTTTAAAGGCCTT
TACTTGTTGGCATGATCTGGTGGGCCCTN
Sequence Type genomic DNA
Unitrap ID UNI31282

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 9307184..9307371 186
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048264 (Dip2c) NM_001081426 DIP2 disco-interacting protein 2 homolog C (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1920179]

 
Come back to gene ENSMUSG00000048264


For any suggestions or comments, please send an email to unitrap@crg.es