Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11094G2
Clone ID IST11094G2
Vector VICTR76
Project tigm

Sequence tag IST11094G2HMF2
Sequence
AGAGCACCCGACTGCTCTTCCGAAGGTGCAGAGTTCAAATCCCAGCAACCACATGGTGGCTCACAACCATCCGTAACAAG
ATCTGACCCCCTCTTCTGGAGTGTCTGAAGACAGA
Sequence Type genomic DNA
Unitrap ID UNI2503 UNI31285 UNI31286

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 36961777..36961890 114
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 98833848..98833961 114
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 55808932..55809045 114
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 85880780..85880893 114
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 78416206..78416319 114
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049624 (Slc17a5) NM_172773 solute carrier family 17 (anion/sugar transporter), member 5 Gene [Source:MGI (curated);Acc:Slc17a5-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 55943408..55943521 114
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078446 (AC153521.7)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 148307826..148307939 114
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 108937212..108937325 114
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 86449420..86449533 114
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038024 (Dennd4c) NP_001074483 DENN/MADD domain containing 4C Gene [Source:MGI (curated);Acc:Dennd4c-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 55003103..55003216 114
NO GENE  


Sequence tag IST11094G2BBF1
Sequence
AGAGCACCCGACTGCTCTTCCGAAGGTGCAGAGTTCAAATCCCAGCAACCACATGGTGGCTCACAACCATCCGTAACAAG
ATCTGTCG

Sequence Type genomic DNA
Unitrap ID UNI31285 UNI31286

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 55943437..55943521 85
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078446 (AC153521.7)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 85880780..85880864 85
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 55808961..55809045 85
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 98833848..98833932 85
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 36961806..36961890 85
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 148307826..148307910 85
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 78416235..78416319 85
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049624 (Slc17a5) NM_172773 solute carrier family 17 (anion/sugar transporter), member 5 Gene [Source:MGI (curated);Acc:Slc17a5-001]

 
Come back to gene ENSMUSG00000049624


For any suggestions or comments, please send an email to unitrap@crg.es