Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14936D2
Clone ID IST14936D2
Vector VICTR76
Project tigm

Sequence tag IST14936D2HMF1
Sequence
GCCNCATCACCTCTGTCACGTCAGAGTCTGCTAGAGGTGAGGAGTGTGCAGGTCAGCATTTCCTTACCCTCAGTACATGA
GCTCTCTCCCTTTTCAGTTCTAGGGTTCTCTTGGCCCCAGCCCCACAGTTCCTGGTTGGTGCCCCTCCCACAGTGCCGTT
ATTTAAAATAGTGCTTACCCTTGGAGGTAATGTTAACG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 69497809..69498005 195
 
EST/CDNA Est Name
  BY130925.1


Sequence tag IST14936D2HMR1
Sequence
TGGCAACCNGTACTTAGGCGTGGGAGAGGCCTGGAGGCCCAGGGAGACATTGTACGAGTCTGGGACACTGGAATTTATCT
GCTCTATAGTCNGGTAATCCCAGATAAGCCCTGAGCCTGCCGTGTGGACATGGAGACTGGCTTGTCACTCTTCTTTCTAT
GTACCCTGTCTGTAAGGAGGGTTTTCCTGATCCCTCTGCTCATACTAAACTTANAAAACCCCCTCCTTATTGCCTGGCTC
CACTGCCAGTGCTCCTGAGGCCTCCAGGGACTGAATGGTGCCATCCCGGTTTTCNTCNCGTCTCCCTTCTCTGACAGGTC
CTGTTTCATGATGTGACTTTCACAATGGGTCC
Sequence Type genomic DNA
Unitrap ID UNI31287

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 69497461..69497812 338
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018752 (Tnfsf12) NM_001034097 tumor necrosis factor (ligand) superfamily, member 12 Gene [Source:MGI (curated);Acc:Tnfsf12-002]


Sequence tag IST14936D2BBF1
Sequence
GCCNCATCACCTCTGTCACGTCAGAGTCTGCTAGAGGTGAGGAGTGTGCAGGTCAGCATTTCCTTACCCTCAGTACATGA
GCTCTCTCCCTTTTCAGTTCTAGGGTTCTCTTGGCCCCAGCCCCACAGTTCCTGGTTGGTGCCCCTCCCACAGTGCCGTT
ATTTAAAATAGTGCTTACCCTTGGAGGTAATGTTAACTGGAACAAGATGCAGGACTGAGTGCTTCTCTAAGGAAAGAAGG
AGGAAACAGCANTGTTGACCTGCCCTGGAGTCCACCCTCACCTCANCCCTGCTCCGCATCCCTCGTGCTCCTGGGTCACC
NCCNACCGCNCCNAAACCCCANGGCTNANTGNNTCTTGTGCTTCTGGGTGANTACTGNTNTCCNTCNCCGNGAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000018752


For any suggestions or comments, please send an email to unitrap@crg.es