Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14374D5
Clone ID IST14374D5
Vector VICTR74
Project tigm

Sequence tag IST14374D5HMF1
Sequence
ATTTACTACAACATGGATGCACACGGAGAATAACACGTGCAATACACTAAAGAGAAAAAAGCAATTGCGGGGGCTGGGGA
TGGCTCAGGGGCTGAGAGCCACTACGGCTTTTCCAGAGGACAGAGTTCAGTTTCCTGACAGCTACAGTGCCTGGAAGTCC
AGCTCCAGGGGATGCTGTACCTGAGGTCTCTGAGGGCACCTGTGCTCATGTACACACAGCTCCCCACACACAATTATGAA
GAAAATCAATNNGTCTTTAAATAAAAGACAAACACCCACGACCTCACTCATGCAGAAGCTGAAGCTGTTTTCTCCTAGGA
ACAGTAAGATGCCGGTTACTGGGGTTTGAGTGGCGGANGCTGGATGTGCNNCNCCNTCGTTC
Sequence Type genomic DNA
Unitrap ID UNI31160

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 28625962..28626342 367
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074243 (AC164532.4-202)  


Sequence tag IST14374D5BBF1
Sequence
CACAGTGAACCATTTACTACAACATGGATGCACACGGAGAATAACACGTGCAATACACTAAAGAGAAAAAAGCAATTGCG
GGGGCTGGGGATGGCTCAGGGGCTGANAGCCACTACGGCTTTTCCAGAGGACAGAGTTCAGTTTCCTGACAGCTACAGTG
CCTGGAAGTCCAGCTCCAGGGGATGCTGTACCTGAGGTCTCTGANGGCACCTGTGCTCATGTACACNCAGCTCCNNACAC
ACAATTNTGAAAAAAATCNNTNNNTCTTTAAATGAAAANACAAACACCCNCNACCTCACTCATGCNNAAGCTGANNCTGT
TTTCTCCNANGAACNNTNNNATGCCNGTNACNGGGNTTTNAT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000074243


For any suggestions or comments, please send an email to unitrap@crg.es