Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12861A8
Clone ID IST12861A8
Vector VICTR76
Project tigm

Sequence tag IST12861A8HMR1
Sequence
AAGCTTTTCCGAGAGCACTGCAAGGCGTTCCTTTCTAAGGCNACCCGGCTCACACTCTTAATCCTGCATCGTTCTCAGCT
GTGACCTTAATTCCTTANTGCGACTTTTAAAATTAACTTTGGCAGCGCTGAGCCGAACCTTGCGGCCTCTCGCGTTACTA
AGCAAGCACTGCCATTGAACTGCACACANNNATCTTTTTNAAAACAAAAAAATTTTTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI12760

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 35379269..35379489 209
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019432 (Bat1a) NM_019693 HLA-B-associated transcript 1A Gene [Source:MGI Symbol;Acc:MGI:99240]


Sequence tag IST12861A8BBF1
Sequence
GCTTCCCCAGAAGTGCGCGACACCATCGGCCACGCACAGAGGCAGCCATTCACAGAGAGCTCCAAATAAGGCAGCGAAAG
CGGGGTCAAAGGGCTGGACGGGCCCCGGAGCGAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 35379155..35379272 118
NO GENE  

 
Come back to gene ENSMUSG00000019432


For any suggestions or comments, please send an email to unitrap@crg.es