Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10980D6
Clone ID IST10980D6
Vector VICTR76
Project tigm

Sequence tag IST10980D6HMR1
Sequence
TGGTCNTATTCNTCTGAGTGCTGGTGTATTAATTATTCAGGGTTATGGTGGAGGCTCTTCAAAGTTTTTTGTTTTCATTT
GGTTTTGCGACAGGGTCTCTCACTCTGTAGTCCTGGCTGTCGTAGAACTCACTGTGTTC
Sequence Type genomic DNA
Unitrap ID UNI10418

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 138033680..138033817 134
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040268 (Plekha1) NM_133942 pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 1 Gene [Source:MGI (curated);Acc:Plekha1-002]


Sequence tag IST10980D6HMF1
Sequence
ACCNAGNGAAGAAGGAAATGAAAACCCTNAANGGAAAAACAAAATTATTTTTCAAACACAAGACTTTGGAACTGGGCCTG
AGAGTGAGGCATTCTAACCAGAGCTCCCTGGCTAAGCTTAGGGTCACAGAGAAGAAGTCAAAGTACACCCCATGAAATGC
CACANAAAAAAATTCATCCNAAAANCAAAAAAAAAANCCCNAAAAANNAAAAAN

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000040268


For any suggestions or comments, please send an email to unitrap@crg.es