Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13057A10
Clone ID IST13057A10
Vector VICTR76
Project tigm

Sequence tag IST13057A10HMF1
Sequence
AACACCAGCCAGTTAGTGTCACCTACGTGTGCCATATACCACATTACTCACGCTGGATGCCCAGAGAGGACACAAGAACC
CCTGCAAGGCCCTTCCTTTCTGTCTCACAGCTGTGCCCTGCCTGCCTAGTGCCCTTAGCTCCTATCTTTCCTCCTTGGCA
CCAAGCCAGTGAGTGGCCTTGTCCTACCACCTATGGGGTGTCTTCATGCACTCCGGCTTGGGGGGTACACTTCCTGCCCT
TCCTACTTGCCTCTATCTGCTTTCCTGTGCCCTACCCCATTTCTACTGCCTCCCTTCTCTTTTGCTCTTCTCAAGANCTC
CCCAATATTCCTCCNAAGTCAGANGGTGACCCCTCTGGACCTCCTGTTGGA
Sequence Type genomic DNA
Unitrap ID UNI14695

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 25939782..25940151 364
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074274 (D930028M14Rik) RIKEN cDNA D930028M14 gene Gene [Source:MGI Symbol;Acc:MGI:3687343]


Sequence tag IST13057A10HMR1
Sequence
GTGTTGGCAGCGAGGATGTACTGTGCCCAGCTCTCTTGTCTGACAGCTGAGAGCATCTGTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 25939727..25939786 60
NO GENE  


Sequence tag IST13057A10BBF1
Sequence
AACACCAGCCAGTTAGTGTCACCTACGTGTGCCATATACCACATTACTCACGCTGGATGCCCAGANAGGACACAAGAACC
CCTGCAAGGCCCTTCCTTTCTGTCTCACAGCTGTGCCCTGCCTGCCTAGTGCCCTTAGCTCCTATCTTTCCTCCTTGGCA
CCAAGCCNGTGAGTGGCCTTGTCCTACCACCTATGGGGTGTCTTCATGCACTCCGGCTTGNGGGGTACACTTCCTGCNCT
TCCTACTTGCCTCTATCTGCTTTCCTGTGCCCTACCCCATTTCTACTGCCTCCCTTCTCTTTTGCTCTTCTCAAGANCTC
CCCAATATTCCTCCNAAGTNNGANGGTGANCCCTCTGGANCTCNNNNNNNNNNNNTACCTCAAAAGGAATGCNCTCCCTA
NCCCTCCCCTTTGCTGGGGGAAAAANNNNNNNNCTCCAGTTCTTGNNCCCACCCCACCCCATACCTCTTTTCNTGCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000074274


For any suggestions or comments, please send an email to unitrap@crg.es