Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14975A9
Clone ID IST14975A9
Vector VICTR76
Project tigm

Sequence tag IST14975A9BBF1
Sequence
ACATGAGGTGCTTGGGAGAGAACAGGAAGGTCAGTGGGTTAGATTTGGGGTGCCAAATGCATTTTCTATCCATGCCAATC
ACCTTGTTTCTGCCTGTCAGGAGCACTAGGTANAAAGGGACTCTAAGAGTAAGGAAGGAAGGGACTCACCCCAGGTCAGT
GGCATCTGCTATAGCAATGGGAAGGAACGGAACTCAGCCACACATTCATCATAAGGACTTGGTCTTAAGGTCTTCAGTGA
CAANAACTTACATAGCTGGCTGTAGGGATGGAGGGAGCTGGGTGCAGTCTTGGTGGCTTANAGGTGCTGAGTGGGCCNGA
GGACCATACAAAGGAGAGGAGGAACGTCTTANGGAGAGATGCCAAGTGCCCCANACTCCTGATGGATCT
Sequence Type genomic DNA
Unitrap ID UNI12825

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 99321016..99321403 376
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032470 (Mras) NM_008624 muscle and microspikes RAS Gene [Source:MGI (curated);Acc:Mras-001]


Sequence tag IST14975A9HMR1
Sequence
ATGTAACTAGCCGTCATCCTTTTTCTTGGGAAGGGCTTGGGCTCTTCACAAGCTCTTGCTTGGTCTTCTTTGGATGACTC
TATCATTAACTCATGCTAACTCAATAGCTTCTCTTTCTCCTAGCATCCTCCACCATCAAGAGAACCANACAGCACTCGGG
AGGCAGAGGCAGGCGGATTTCTGAGTTCGAGGCCAGCCTGGTCTACAAAGTGAGTTCCAGGACAGCCAGGGCTATACAGA
GAAACCCTGTCTCAAAAAAAAGAGAGAGTGAACCANANGAACAACNCTGGAAGCAAGCAAGTAGAGGGCCCAAGCGACCT
TGTTCACCCTGTACCTTANGCATCTTCTATCATAAGCATCCACATTTGGGTCCTCCTCACAAGTNNNNGGTGTCTTCCNN
ACAGGGCCTGGGCACCCATTTACCGTCNNNCATTGACTCTCTGANCGGTGTGCAGGAACCTTTGGCTGCANTCATGACAC
TAANGGTCATGTCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 99321400..99321892 459
 
EST/CDNA Est Name
  BG970263.1 - BB598778.2 - AA035915.1 - AI322609.1 - AA200952.1 - CA326917.1 - BF471128.1 - CA895583.1 - CJ148499.1 - CX221847.1 - CJ150003.1 - BU516648.1 - CJ149909.1 - CJ146036.1 - CJ148934.1 - CJ155524.1 - BY309786.1 - BY323181.1 - CJ162751.1 - BY008155


Sequence tag IST14975A9HMF1
Sequence
NNNNGAGGTGCTTGGGAGAGAACANGANNGTNNNTGNNNNNNNTTTGGGGTGCCAAATGCATTTTCTATCCATGCCAATC
ACCTTGTTTCTGCCTGTCAGGAGCACTAGGTAGAAAGGGACTCTAANAGTAAGGAAGGAAGGGACTCACCCCAGGTCAGT
GGCATCTGCTATAGCAATGGGAAGGAACGGAACTCAGCCACACATTCATCATAAGGACTTGGTCTTAAGGTCTTCAGTGA
CAAGAACTTACATAGCTGGCTGTAGGGATGGAGGGAGCTGGGTGCAGTCTTGGTGGCTTANAGGTGCTGANTGGGCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene BG970263.1 - BB598778.2 - AA035915.1 - AI322609.1 - AA200952.1 - CA326917.1 - BF471128.1 - CA895583.1 - CJ148499.1 - CX221847.1 - CJ150003.1 - BU516648.1 - CJ149909.1 - CJ146036.1 - CJ148934.1 - CJ155524.1 - BY309786.1 - BY323181.1 - CJ162751.1 - BY008155


For any suggestions or comments, please send an email to unitrap@crg.es