Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14842A2
Clone ID IST14842A2
Vector VICTR76
Project tigm

Sequence tag IST14842A2HMF2
Sequence
GTGNNNNNNNNNNNNNNNNNNNNNNNNNCNTGNNNNNNNNNNNNGACTGGGGACCAGGAAGCAAGGATGGGAGAACTCAN
TTGGTTTTTCCTTCTTCCCTTTTTATTCAGTTCCAAGTTCTATCCTAGGGGGGGCTGCCGTANGTCTTCCTGGANAAGCC
CTCACAGACATACCTANAAGGTGTGCCTCGCTAATGCTCTGGGTACTTGTTTTANGAGGTTGNAN
Sequence Type genomic DNA
Unitrap ID UNI11232

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 28096825..28097002 168
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040488 (Ltbp4) NM_175641 latent transforming growth factor beta binding protein 4 Gene [Source:MGI (curated);Acc:Ltbp4-001]


Sequence tag IST14842A2BBF1
Sequence
GTGACTATAGGTGAAAGTCAAAGAAAAGCTTGTGGGGATTGGTTCTGTCCTTCTACCAAGTAGGTCCCAGGTATTTAGTT
GCTCAGACTTGGTAGCAAGTACCCACTGTTTAGCTCACAGCTCAAGAATATGCATGCTTTCTAATGTTGATTTTTTTTAT
ATACCAAATAAGATACCAAAAAGTGTTTCAGTGACTTTTTCTGATGAATTTAGGTATCCAAATATTACCAAGCACAGAGC
TACTCTGGATTACAGANATTTTAAGTGTCTACATTNNNNTTTCACACATGCAAGTGATATTCATTTTGNANTTANAATTT
TCAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 51966839..51967162 308
NO GENE  

 
Come back to gene ENSMUSG00000040488


For any suggestions or comments, please send an email to unitrap@crg.es