Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P086H03
Clone ID P086H03
Vector FlipROSACeoC-2
Project ggtc

Sequence tag P086H03
Sequence
GAAATTGGTTGNNNAAGAAGGGTTNNNGGTGNNNGAANNNGGCTTGGGGNNNGATATTGGGNNNGAGAAATTCTTCAATA
TCAAATGCCGAGCTTCTGGCCTGGTGCCCAACGTTGTCGTGCTGGTAGCCACCGTTCGAGCTCTGAAGATGCATGGAGGC
GGGCCGAGTGTAACTGCTGGGGTTCCTCTCAAGAAAGAATATACAGAGGAGAACATTCAGCTGGTAGCTGATGGCTGCTG
CAACCTACAGAAGCAAATTCAGATCGCTCAGCTCTTCGGGGTGCCGGTGGTGGTGGCACTGAATGTCTTCAAGACGGACA
CCCGTGCAGAGATTGACTTGGTGTGTGAGCTCGCTAAACGGGCCGGTGCCTTTGATGCGGTCCCCTGCTATCACTGGTCG
GCTGGAGGGAAAGGATCTGTGGACTTGGCCCGGGCTGTGAGAGAAGCTGCGAATAAAAGAAGCCGCTTCCAGTTCCTGTA
TGATGTTCAGCTTCCCATCGTGGAAAAGATAAGAGTCATTGCCCAGACTGTCTATGGAGCCAAGGACATTGAGCTGTCTC
CTGAGGCGCAGTCCAAAATCGATCGCTATACGCAACAG
Sequence Type mRNA
Unitrap ID UNI10947

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 6243198..6262793 179
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040675 (Mthfd1l) NM_172308 methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-like Gene [Source:MGI (curated);Acc:Mthfd1l-003]

 
Come back to gene ENSMUSG00000040675


For any suggestions or comments, please send an email to unitrap@crg.es