Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P124B03
Clone ID P124B03
Vector ROSAbetageo+2
Project ggtc

Sequence tag P124B03
Sequence
TTCTNNTTTTTTTACCTCCCCATAGACTGGCAGTCTCGTGGCGGGGGGCCGCGCGGAGGTTGAATTCGATCGAGAGACCA
GGAACTTCAAAATAGTGCCTGGGATCCGGATGACAGCAGGCATTAAGGGCTGGCTACTGGACTGAAGCTGCTGGAAACTT
Sequence Type mRNA
Unitrap ID UNI433

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 160513510..160514099 93
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040749 (Siah1b) NM_009173 seven in absentia 1B Gene [Source:MGI (curated);Acc:Siah1b-002]


SPLK-Sequence tag 3SP124B03
Sequence
TAGTGTTTTTGAACATTACTTTGCTCTAAGGGTTTCTCAACTTCTTTGCAGTTTATTAATTCATGTAGGAGAGGAAACTC
ATTACTAGTGCTAGGTTAGTTCCACCCGAGGCTTGAAAGTGCATCATGAACACACTGCCACTGGCAGTTTCTTTTCTCCA
GCATTGATTGTAGTTTCACTGAAAGGAATTAGCCCTGACCAAAATACATTCCTGGCTGCTGGTTATGCCTACACCCTCCC
TC
Sequence Type genomic DNA
Unitrap ID UNI433

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 160511747..160511988 242
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040749 (Siah1b) NM_009173 seven in absentia 1B Gene [Source:MGI (curated);Acc:Siah1b-002]

 
Come back to gene ENSMUSG00000040749


For any suggestions or comments, please send an email to unitrap@crg.es