Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10922F5
Clone ID IST10922F5
Vector VICTR76
Project tigm

Sequence tag IST10922F5BBF1
Sequence
ACCTGAACACCAGCCTGGCTCACCGGCTGGTTTGCCCAAACCTGACTTACCCTGGGGTTGGAGCCATGCCGGGAGGCCTC
TCCTGCCAGGTTGTACTAACACTGTTTTTGTCTTTATCCAGGTACATTGAGCGGAAAGCTTTTCTGGATCGAGTGGACCA
CAGGCAGTTTGAAATTGAGCGAGATCTG

Sequence Type genomic DNA
Unitrap ID UNI10744

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114292622..114292808 187
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031954 (Cfdp1) NM_011801 craniofacial development protein 1 Gene [Source:MGI Symbol;Acc:MGI:1344403]


Sequence tag IST10922F5HMR1
Sequence
NGTGACNACTCAGGATGCTCTCACTCTATCCAAACCACTTCCCTTCTGTCCACAAAAGGATGATTCTGTTCNGCCAGGAA
TGAAACTACACCGTAAAAGGATGGGTTTTCTGTTTGTTTTGAGACAGGGTTTCACTCTGTAGCCCAGGCAGGCCTCAAAC
TCAGGGCCTCTGCCTCCTCAATGTTGGGATTAAAGGTCTGCACTAGCACACNAGGAGAGAAAACATCTTACAAGGAGAAA
GTAAACGANAGTTATCAAAGCATTCAACGTTGTCNCAGGACTTGGAGGAAACGANAAATAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114292807..114293105 285
 
EST/CDNA Est Name
  BQ043678.1 - BY433112.1 - BB689709.1 - BB689731.1 - CJ216410.1 - BY611115.1 - BB689730.1 - BB689157.1 - CJ218029.1 - CJ218443.1 - CJ302793.1 - CJ208399.1 - CJ217958.1 - CJ210040.1 - BY639701.1 - BY380601.1 - CJ208031.1 - BY683316.1 - BY633860.1 - BY603648

 
Come back to gene BQ043678.1 - BY433112.1 - BB689709.1 - BB689731.1 - CJ216410.1 - BY611115.1 - BB689730.1 - BB689157.1 - CJ218029.1 - CJ218443.1 - CJ302793.1 - CJ208399.1 - CJ217958.1 - CJ210040.1 - BY639701.1 - BY380601.1 - CJ208031.1 - BY683316.1 - BY633860.1 - BY603648


For any suggestions or comments, please send an email to unitrap@crg.es