Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11561E8
Clone ID IST11561E8
Vector VICTR76
Project tigm

Sequence tag IST11561E8HMF1
Sequence
CTGATAAAGCCNGAAATANTANTTACTCATTTTGCTTGATGTCTATTACCACACACTCGTGGACTTCGGAGCTTTCGCAC
CAAGTCTGATTGCTAGTGACTAGTTTGTGGGTTA
Sequence Type genomic DNA
Unitrap ID UNI30065

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 45589973..45590085 107
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023935 (Spats1) NP_081925 spermatogenesis associated, serine-rich 1 Gene [Source:MGI Symbol;Acc:MGI:1918270]


Sequence tag IST11561E8HMR1
Sequence
ATCNGGTTTTAAAAGGATAATGTAATGGGTTTTGTGACATTCCCATACGTGTATATTAATGGAGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 45590081..45590146 64
NO GENE  

 
Come back to gene ENSMUSG00000023935


For any suggestions or comments, please send an email to unitrap@crg.es