Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15077A12
Clone ID IST15077A12
Vector VICTR80
Project tigm

Sequence tag IST15077A12HMF1
Sequence
AACTAAGAGGGCAGAGTCACATCAAAGATCAGGGTTCATCTGATGGA
Sequence Type genomic DNA
Unitrap ID UNI31297

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 84313630..84313675 46
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020037 (Rfx4) NM_027689 regulatory factor X, 4 (influences HLA class II expression) Gene [Source:MGI Symbol;Acc:MGI:1918387]


Sequence tag IST15077A12HMR1
Sequence
TTGCACAGTGACTTTGCTTTTTCTTGGCAGCTCTTGGAGCCNGTTCTTCTATTTAAACATTCNTCTTTTTTTNACGATTC
CTTCCTTTTCTTTCNAAATATTTTCCAAGTATATTCTTCTCTATGATATTTAAATCCTGTGTGTGTGTGTGTGTGTGTGT
GTGTGTGTGNNNGNGCNCNCNCG
Sequence Type genomic DNA
Unitrap ID UNI30823

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 59887790..59887958 161
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026987 (Baz2b) NM_001001182 bromodomain adjacent to zinc finger domain, 2B Gene [Source:MGI (curated);Acc:Baz2b-001]

 
Come back to gene ENSMUSG00000026987


For any suggestions or comments, please send an email to unitrap@crg.es