Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14732B9
Clone ID IST14732B9
Vector VICTR76
Project tigm

Sequence tag IST14732B9BBF1
Sequence
GTAGTTACTTATGAAGAGAGGAGAGGAGAGCTCCAAAGGGGACAGGAGACTCCTTGGGTTAGATGTAAATGCCGGGCTGA
TACCGGGCTGGAAGAAAAAGCCCCCTCCCCCTGAGCCCTCCCCCTTTACACTATCCTCTCTGTGGGTGTGGTCAAGGCAA
GCTGGTGCTNNGCTTTTGGCTTTTGGGTTCGGAAACCGCTGGCTGCCNCGCTCCTCCTCTGCCCNNGCCNGTCCNCN
Sequence Type genomic DNA
Unitrap ID UNI20638

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 35188164..35188397 222
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000007041 (Clic1) NM_033444 chloride intracellular channel 1 Gene [Source:MGI Symbol;Acc:MGI:2148924]


Sequence tag IST14732B9HMF1
Sequence
NTANTTACTTATGAANAGANGAGAGGAGAGCTCCAAAGGGGACAGGAGACTCCTTGGGTTANATGTAAATGCCGGGCTGA
TACCGGGCTGGAAGAAAAAGCCCCCTCCCCCTGAGCCCTCCCCCTTTACACTATCCTCTCTGTGGGTGTGGTCAAGGCAA
GCTGGTGCTAGGCTTTTGGCTTTTGGGTTCGGAAACCGCTGGCTGCCGCGCTCCTCCTCTGCCCAGGCCTGTCCCCTCCG
GCACCACCCTTCCCCATACCCCCGTGCACGTCCCTTCCTCTCCGGGCAGGTCCTCTCCCAGTGAGCACATTCNCACTCGT
TTTTTGCTTNNNNGCCNNNCNTGNNNTTCCTTTCNTTCNTCCCGTCTGTGTGTCGGTGTTT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000007041


For any suggestions or comments, please send an email to unitrap@crg.es