Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P124C09
Clone ID P124C09
Vector ROSAbetageo+2
Project ggtc

Sequence tag P124C09
Sequence
ATANNTAACACAATAAAGAAGAACCAACCGCATCTAATNNACCCCCACACCACCCACCANNCCAGGCGATGGGGGGAGGG
TAGACATCTTACTAGCTTGCCATGAAGGACTAATTGAAGGAAACCCGGAACGTACCGGGAAAATACACCTCTTCCTTTTA
CATTAACCCNNGTCTCGGTGTCTCGATCCGGGGCATCACGAAAGACTCTACAGGAGCAGGTAATTCACTGGTCCACAAGC
GGTCTCCTTTACGTCGAAACCAAAAGACCTCAGCATCCTTGAACAAGCTGTCTTTACAGGATGGACATAAAGCCAAAANN
NCAGCATGTAAATTTGAAGAGGGTCAAGATGTCTTAGCTAGATGGTCAGATGGCTTGTTTTATCTTGGAACTATCAAAAA
GATAAACATATTGAAACAGAGCTGCTTCATCATATTTGAGGACAGTTCCAAATCCTGGGTTCTCTGGAAGGACATCCAAA
CAG
Sequence Type mRNA
Unitrap ID UNI3145

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 108489758..108510237 193
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029267 (Mtf2) NM_013827 metal response element binding transcription factor 2 Gene [Source:MGI (curated);Acc:Mtf2-001]


SPLK-Sequence tag 5SP124C09
Sequence
TTAAGTGGTATGCAGAGATAGAAAGGTGTAAAGGCTTGAAGTCCTGTCAAACAAGCACCTAGTTAGTGGGTGAGGTGAGT
GGGTGCTCTGTGCTTGAAAGTGCTGTGAGAAAC
Sequence Type genomic DNA
Unitrap ID UNI15236

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 108510952..108511064 113
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029267 (Mtf2) NM_013827 metal response element binding transcription factor 2 Gene [Source:MGI (curated);Acc:Mtf2-001]


SPLK-Sequence tag 3SP124C09
Sequence
TTACAAATGTCAATCCCAGCACTTGGGAGGCAGCAGAAATATAGNTTCTACAGTGCTTTGTTCCAGGACAGCCAGGGCTA
CATAGTAAAACCTTGTCTTGAAACACAACAAAACACAAAAAAGAAAGAAAAAAAGAAGAGAAAGAGAAACCTGTTTATAA
TTATGATTTATAATTATG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000029267


For any suggestions or comments, please send an email to unitrap@crg.es