Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10355H5
Clone ID IST10355H5
Vector VICTR76
Project tigm

Sequence tag IST10355H5BBF1
Sequence
GTGTGTGTGCGCGCGCGCGCATGTGTGACATCCACACATACATATTCTGTTTTAGGACTATTTCTCTGAAATAAACAGGC
AACCGCTTTATCTGATGGCAGCAGTGTTGTGTCTGAAGCGGGAGTGCCCCCCCTTTCCCTCCCCTATGAGACTTTCCGAG
GAAGGTCTATGAATGAAGCAGGTGTTTTANAAGTTTTGGCGCACTTGGGAATCCCCCTTTTANAATATTCGTGACGATGA
TAGCGGAGGAGTTGGGGTGCTCAGGTTGGAGCCCTTGGCCATGGANATGGAAGGCGGGCANCGGACNATGATCTGGATGG
CTGCCATCTGCCNTGANGGGAGGATTTTTGAAGGTAGCTNGGGATGACTGTCACAGANACTTCAGTTNATGCGCTTGGCG
GGGGACTCTGTCNGTGGCGGAAGGGCANANCACATGGCCNGGATGTTGACAGGCCTNCTNGNCCGCAAAGGGGAAN
Sequence Type genomic DNA
Unitrap ID UNI30619

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 30916832..30917306 441
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075415 (Fnbp1) NM_019406 formin binding protein 1 Gene [Source:MGI (curated);Acc:Fnbp1-001]


Sequence tag IST10355H5HMF1
Sequence
GTGTGTGTGCNCGCGCGCGCATGTGTGACATCCACACATACATATTCTGTTTTAGGACTATTTCTCTGAAATAAACAGGC
AACCGCTTTATCTGATGGCAGCAGTGTTGTGTCTGAAGCGGGAGTGCCCCCCCTTTCCCTCCCCTATGAGACTTTCCGAG
GAAGGTCTATGAATGAAGCAGGTGTTTTANAAGTTTTGGCGCACTTGGGAATCCCCCTTTTANAATATTCGTGACGATGA
TAGCGGAGGAGTTGGGGTGCTCAGGTTGGAGCCCTTGGA
Sequence Type genomic DNA
Unitrap ID UNI30619

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 30917029..30917306 272
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075415 (Fnbp1) NM_019406 formin binding protein 1 Gene [Source:MGI (curated);Acc:Fnbp1-001]

 
Come back to gene ENSMUSG00000075415


For any suggestions or comments, please send an email to unitrap@crg.es