Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14969C4
Clone ID IST14969C4
Vector VICTR76
Project tigm

Sequence tag IST14969C4HMR1
Sequence
CNACCGGGCCGTGAGCTTGCCTTACGCTGGAGACCTGCTTAGAAAAAGGTTCCTCTGTGGGGAATAGTCAAGCTGAGTTT
TGGGGGATAAAGTTCTTATTTTGTGGCACCCTAACTCGCTGAGGGACCATAGGATTTCGGGGGTAGATTANATAGATGTC
AAGCCCCTGACAGCCTANGATCTTTTCTATACNTCACANAACTTAATAATTTCACTTTCACCANAATTATATGA
Sequence Type genomic DNA
Unitrap ID UNI20618

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 109046621..109046852 222
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030649 (3200002M19Rik) NM_027532 RIKEN cDNA 3200002M19 gene Gene [Source:MGI Symbol;Acc:MGI:1922680]


Sequence tag IST14969C4HMF1
Sequence
GGTGGTANACCTCCATGCTGCACTGGGTCCTCACTCACCCAGGCCTGATGCTGCTGCTCCTGCTGCTGCAGCTCTGTCTC
CTCCACACAGGGTCGGTCCAGATTAAACCACAGTGTCTCAGTCACACGAGGGAAGAGTGACGGGAACAAGGTGGACATGG
CTCCTAAGCTGAGGGAAAGGGTCACGTGAATATGTTTTGTTTTGTTTTGATGCAGTTGAAATTTGATTTAGGGATAGGGT
GGATTGGGTGGGTAGCAGAGAAGCTGCCCTGCCCNCNTGANNTCNNACANANNTGANTTTGANTCNNGGNNCCNNCNCTT
N
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14969C4BBF1
Sequence
GGTGGTAGACCTCCATGCTGCACTGGGTCCTCACTCACCCAGGCCTGATGCTGCTGCTCCTGCTGCTGCAGCTCTGTCTC
CTCCACACAGGGTCGGTCCAGATTAAACCACAGTGTCTCAGTCACACGAGGGAAGAGTGACGGGAACAAGGTGGACATGG
CTCCTAAGCTGAGGGAAAGGGTCACGTGAATATGTTTTGTTTTGTTTTGATGCAGTTGAAATTTGATTTAGGGATAGGGT
GGATTGGGTGGGTANCANANANNCTGCCCTGCCCTCNTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 109046348..109046623 266
NO GENE  

 
Come back to gene ENSMUSG00000030649


For any suggestions or comments, please send an email to unitrap@crg.es