Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14504H11
Clone ID IST14504H11
Vector VICTR74
Project tigm

Sequence tag IST14504H11BBF1
Sequence
GGTACCTCGCTCCTAAACCCTAAATTCCACTTTTGTCCTGTCACATCACTTCACCCTCCTAGCAAACAAGTCTGAGGGAC
TGACTGAGAGAGCAGGGACAGGCTTGCTGGATTTGCAGTGCAACACGACCCGACTCAGCTTTCAGAACGCGCCTGGCCCC
GGTGCCTTCTGGGAGGTGTAGTCAGAAAAGACCTCAGGCATGCCGGGAGTAGTAGTTCTCTGGGGCTTCTCCCGGTGGCG
GGGCTGCTCGCGGCGTTTTGGGGGGCTCCTGGTGGAGGTGATCCTGACTGTGCTAGGAGAGAGCGTCTGGGGCCGACATC
CTCGANACTGCTCGTGCTGANAGTGGTGGGAGCGAGCGCCGGCGTCCGTGANTGGGGTGAANANGGGCNACCGGGCNTAN
CGGGCGGTGGGCTTCCCGGCGAGCCCNGCGCGGCCTGGCNNCTGCTCTGNGN
Sequence Type genomic DNA
Unitrap ID UNI21687

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 50640998..50641447 424
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000044807 (Zfp354c) NM_013922 zinc finger protein 354C Gene [Source:MGI (curated);Acc:Zfp354c-001]

 
Come back to gene ENSMUSG00000044807


For any suggestions or comments, please send an email to unitrap@crg.es