Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P127E11
Clone ID P127E11
Vector ROSAbetageo+2
Project ggtc

Sequence tag P127E11
Sequence
TGTCTGTGCGGCGAGAAGATGGCGGCGACGGGAGACGCGGCGTGAGAAGCCGGAGCAGCACCGAACCTCATTGAGNNNNG
CCGGCATGGGCCTCCACAACCCACAGTATATCTTTGGCGATTTCAGCCCTGATGAATTCAATCAGTTTTTTGTGACTCCC
CGCTCTTCTGTTGAGCTCCCTCCATACAGTGGGACTCTGTGTAGCATACAGGCTGAAGATGAACTGCCAGATG
Sequence Type mRNA
Unitrap ID UNI10955

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 122434734..122460488 94
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031826 (Usp10) NM_009462 ubiquitin specific peptidase 10 Gene [Source:MGI Symbol;Acc:MGI:894652]


SPLK-Sequence tag 3SP127E11
Sequence
CAACAGCATTTGTGTCTCAGCGGGGAGCCATCCAAGCACAAGCACATTAGTGTTTGTGGCTGGCAGCTCCAGGCATCGTG
GATGTGCTTGGATGTGCAGTATCATAGAATCTAGACTCTAGGTGTAATAGAAGCCATTGGTTTTTGGTAATCCATTCTAA
AGTGAGGGAAAAAAAATTGCTCAGTCAGTGACCTGCTGCAAGCACAGGCAAAACTGCTGTGTTACTGCTAGTCACTGTTT
GGGGTAGGATTGCCTTTCTTTCTTCCCCAGCTATAGGCACCTCTACCGCACAGTCAGCATGTCACTCACTGGCTTAGGCA
CCTCTACCCCACAGTTAGCATGTCATTGGCTTTCTGCTGGACCTTCATTTCCCATCACAAGCCCTCCAGGGTTAAACATC
CTTAGGACATAATTTTTGGGTTATAATTCTGTTCTTGAAATAAGGGACTTAAAAAACTGTTGCCACCTTGTACTACAGTT
TAAGGCATTAATTTTAGATGCATGGCATTTCANNGNTCTTCCATGTTGTTGAAGGATACAGTTGATTCTAGTAACCTACT
TGCAAAGATGTAGACTAAGATACAGTGTCCACCGTGACATGTATGGGAGGAGCAGGTTAACGCTAACTGGGAAGAGCACA
TACTAGAGCTCGCAGTGTG
Sequence Type genomic DNA
Unitrap ID UNI12824

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 122463408..122464066 653
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031826 (Usp10) NM_009462 ubiquitin specific peptidase 10 Gene [Source:MGI Symbol;Acc:MGI:894652]

 
Come back to gene ENSMUSG00000031826


For any suggestions or comments, please send an email to unitrap@crg.es