Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12579H11
Clone ID IST12579H11
Vector VICTR76
Project tigm

Sequence tag IST12579H11BBF1
Sequence
GCCCTACAGATAGTACAGGTCACCAGGCTACTAGCTACATCCATTCCCAGCTTTCCAAGTGGATAACAGGTAAATATACG
CTTTGTTGAGGAGACAATTTANCTTCCCTAAGGCCTGCCTATCTGTGAGCACAAGAACCTGGAGCCCTCTACCCCACACC
TGGCTTTA
Sequence Type genomic DNA
Unitrap ID UNI14978

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 113290607..113290774 166
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031750 (Il34) NP_001128572 interleukin 34 Gene [Source:MGI Symbol;Acc:MGI:1923777]


Sequence tag IST12579H11HMF1
Sequence
GCCCTACAGATAGTACAGGTCACCAGGCTACTAGCTACATCCATTCCCAGCTTTCCAAGTGGATAACAGGTAAATATACG
CTTTGTTGAGGAGACAATTTAGCTTCCCTAAGGCCTGCCTATCTGTGAGCACAAGAACCTGGAGCCCTCTACCCCACACC
TGGCTTTAAAAAAAAAATTTTTTTNNNNANNCNNNTGGTNNCNCNNGCCTTTAATCCCNNNNNTTGGGAGGNANANGCNG
GN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000031750


For any suggestions or comments, please send an email to unitrap@crg.es