Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P106A03
Clone ID P106A03
Vector ROSAbetageo0
Project ggtc

Sequence tag P106A03
Sequence
AGTCCTTTCTGCTCTTTNNNGCTGCCGAGGAAGCATCGCTGAAGGCTCTCGTAACTCNNNCGTCATGTCTAAGTCCGAGT
CTCCCAAGGAGCCAGAACAGCTGCGGAAGCTCTTCATCGGAGGGCTGAGCTTCGAAACAACCGACGAGAGTCTGAGGAGC
CATTTTGAGCAATGGGGAACACTAACAGACTGTGTGGTAATGAGAGATCCAAACACCAAGAGATCCAGGGGCTTTGGGTT
TGTCACATATGCCACTGTGGAAGAAGTGGATGCTGCCATGAATGCAAGACCACACAAGGTGGATGGAAGAGTTGTGGAAC
CTAAGAGAGCTGTCTCAAGAGAA
Sequence Type mRNA
Unitrap ID UNI10804

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 123599032..123599372 329
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000058922 (AC165425.2)  


SPLK-Sequence tag 5SP106A03
Sequence
GTTTTTCTCCCCAACCTGAGACTATGATTGGGGCAGTCCTCAATTGGGAGAT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SP106A03
Sequence
TGGGCCACCACACCTTCCCAGTCATTTAGAAACTGCTACTACTAAATAACTGAAGTCATTTTTCCTTTTTAGGATTCTCA
GCGACCAGGTGCCCACTTAACTGTGAAAAAGATCTTTGTTGGTGGTATTAAAGAAGACACTGA
Sequence Type genomic DNA
Unitrap ID UNI29531

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 103072262..103072404 143
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000046434 (Hnrnpa1) NM_010447 heterogeneous nuclear ribonucleoprotein A1 Gene [Source:MGI Symbol;Acc:MGI:104820]

 
Come back to gene ENSMUSG00000046434


For any suggestions or comments, please send an email to unitrap@crg.es