Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13354H7
Clone ID IST13354H7
Vector VICTR74
Project tigm

Sequence tag IST13354H7HMF1
Sequence
CCNTCAGTCTTCCCCAGGCGCCAGGGAAGTTCCTCCTTTGGGGTTTTTGTTTTTGAAAGTTGCAGCTTCCCCTTGGCGCA
GCCACAGCTGCTTTGGGCCGTTGGTAGAACTGACAGGAAGAGGCGGGGCCCTTCCTGTGGTGCCTGTGGAGCTGTGGTTG
GCCCCGCCTCCACCTACACCCCCCAGGCCCTAANTACGCAACCTGCCTTGGCGCTGGCCCCTCCATCCTTCTTCCTCTGG
TGTGTGTN
Sequence Type genomic DNA
Unitrap ID UNI13770

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 4294402..4294648 243
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024858 (Adrbk1) NM_130863 adrenergic receptor kinase, beta 1 Gene [Source:MGI Symbol;Acc:MGI:87940]


Sequence tag IST13354H7BBF1
Sequence
CCATCAGTCTTCCCCAGGCGCCAGGGAAGTTCCTCCTTTGGGGTTTTTGTTTTTGAAAGTTGCAGCTTCCCCTTGGCGCA
NCCACAGCTGCTTTGGGCCGTTGGTAGAACTGACAGGAAGAGGCGGGGCCCTTCCTGTGGTGCCTGTGGANCTGTGGTTG
NCCCCNCCTCCNCCTACNCCCCCNANGCCCTAANTACCCNNCNTGCCNTGGCGCTGGCCCCTCCANCNNTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000024858


For any suggestions or comments, please send an email to unitrap@crg.es