Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14451A1
Clone ID IST14451A1
Vector VICTR74
Project tigm

Sequence tag IST14451A1HMR1
Sequence
TAGCNNGGAGCGAGGTGCTGGCATGGGGCAGGGCATTGTTGATCTCAGGCAGGGGAAGCTGATAAGTTACTGCTTTGGGT
GGGTCTTGGGCACCAGAGGGCCAGCACTTCCTCTGTTTTCTAGCN
Sequence Type genomic DNA
Unitrap ID UNI18902

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 125647256..125647379 120
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029478 (Ncor2) NM_011424 nuclear receptor co-repressor 2 Gene [Source:MGI (curated);Acc:Ncor2-002]


Sequence tag IST14451A1HMF1
Sequence
GCTATACCCACCTCAATGCTTCCCAAACCCCCAGAAGTCCTCTTCCAGTCCCTAGATGCCCAGACAAGGGACTCAAGGCA
CAGAGAGGGCAGCACAGACCTGAAGGTCACACAGCAAACCTGCAATACTGACTGCCTTGGTGTGTTCCCACGAAGCTGTG
ACAAGGACAATAGGTGCCAGGGACACAGTGGGGTGGGGTGGGGGGGNTT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 125647376..125647581 206
NO GENE  

 
Come back to gene ENSMUSG00000029478


For any suggestions or comments, please send an email to unitrap@crg.es