Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14272B1
Clone ID IST14272B1
Vector VICTR74
Project tigm

Sequence tag IST14272B1HMR1
Sequence
ATCCTTACTGTGAAAAGGTTCAGAATCCGGGTACACATCACTACTTGAAGGAACACGGGGAAAAGTGAAG
Sequence Type genomic DNA
Unitrap ID UNI370

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 29683689..29683758 70
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000069020 (Urm1) NM_026615 ubiquitin related modifier 1 homolog (S. cerevisiae) Gene [Source:MGI (curated);Acc:Urm1-001]


Sequence tag IST14272B1HMF1
Sequence
GGATAATATACTACCAATGTTAGTCACTCCCTCCGTGGCAGCTTATTTACCCCGGTAGCTCCTCTGGACTCTGCAGAAGA
CACTTACCAAACTACTTTGCAAAAGATTAAAATCTAATTAAAACTCCAAGGTATGCCGGGCGGTGGTGGCCCACGCCTTT
AATCCCAGGACTTGGGAGGCAGAGACAGGCGGATTTCTGTGTTCGAGGTCAGCCTGATCTACAGAGTGAGTTCCAGGACA
GCCAAACAGANAGGACCCCTGTCTCGAAAACACACACACACACACACACACACACNNNGTTNGANAAAGANGANNGTCCT
GTCNNGNCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 29683370..29683692 305
NO GENE  


Sequence tag IST14272B1BBF1
Sequence
GGATAATATACTACCAATGTTAGTCACTCCCTCCGTGGCAGCTTATTTACCCCGGTAGCTCCTCTGGACTCTGCAGAAGA
CACTTACCAAACTACTTTGCAAAAGATTAAAATCTAATTAAAACTCCAAGGTATGCCGGGCGGTGGTGGCCCACGCCTTT
AATCCCAGGACTTGGGAGGCAGAGACAGGCGGATTTCTGTGTTCGAGGTCAGCCTGATCTACAGAGTGAGTTCCAGGACA
GCCAAACANANAGGACCCCTGTCTCGAAAACACACACACACACACACACACACACNGNGTTTGANAAAGAAGANNGTCCT
GTNTTGNNNNANACTTCCCNTAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000069020


For any suggestions or comments, please send an email to unitrap@crg.es