Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P107F03
Clone ID P107F03
Vector ROSAbetageo0
Project ggtc

Sequence tag P107F03
Sequence
CACGCGACACCAGCAGCCACAATATNNACACCATCACACCACCACACCANNCAANNNGACCACCGACCCAAACATCCNNT
AACANNCCCACACAANNAACAAGACATACCACACCACAGCCACATAAANNCCACAATCACACCCAAANNAGCAANNACNN
ACACGCAACTCCACCANNACACACCAACAACCACGANNNCACCCACACACTATACAGCACCACGCAACCACAACACACAT
AGACAACACCACTAAGCCAAACCGACACCCCCNNNNGCGAACNNCCCAACCACCGAAGAACGACCATCATCCCCAAACAC
TTACCACCAACACCGGATACCCACATGCAACGCCCCCCTAAACGACACGCGCAAACAAAAGANTNNCAGACATTGCCACA
CCANGGNNGACCCATCGAACAGTTACAAGAGAACCTTTATGTGCCTGTAAAAGAATAGCCTGCTTTTAATTTTCTTGTAT
TTTTTCTTTCACCTANNGGCTNNTCATCTAGGCGGCGGGGGGCAGAAACGGGATGTAAAATAATGGTCCGAGGCAAAGGC
TCAATGAGGGATAAAAAGAAGGAGGAGCAAAATAGAGGCAAGCCCAATTGGGAGCATCTAAATGAAGACTTACATGTACT
AATCACTGTGGAAGATGCTCAGAACAGAGCAGAAATCAAGCTGAAGAGAGCGGTTGAAGAAGTGAAGAAGTTACTGGTAC
CTGCG
Sequence Type mRNA
Unitrap ID UNI4770

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 10431758..10475832 147
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000062078 (Qk) NM_021881 quaking Gene [Source:MGI Symbol;Acc:MGI:97837]


SPLK-Sequence tag 5SP107F03
Sequence
AATTTCACATGAGAGCTATGGCACATTTTAGAATATTTCCCCCTCCACTTCTGCAAAGTTCCCTGAGCACAGAAGTAAGA
GATTAGACGGAGACACTCCTTTTAGTACTGAGTCTCCCAAGCAAGGGCTCTTATCTGTATATTGTCCAATTGTATGTCTC
TATATTTGTTCCCTTCGATTGCTTCTTGATATTGGCTGGGCAAGACACTTATC
Sequence Type genomic DNA
Unitrap ID UNI4770

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 10429594..10429806 211
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000062078 (Qk) NM_021881 quaking Gene [Source:MGI Symbol;Acc:MGI:97837]


SPLK-Sequence tag 3SP107F03
Sequence
CCATTTNNNNNNNGGCTACATAGATAGCTGATGCATTGAAGCACTTTATTGTTGTGTTCTTTTATCAGAACAGTAGTATT
TGGATTTCTTGTCTCAGGTTCCTGGCCATGTGGGTGTTCCATCTCATGAAGTGGGCCTTAATTCCAGTCAGATAGTGGTA
GTTACTCCCATAATGTTTGTATCACTATTGCACTTGTGTATCTACTAGGCCACCATTATAGAACAAATAGATCATACTTG
GATTGGTGTGAACCTGTCTCCTCTTGTATACAGTATGCAGAGTCCTTCTACTACCATGAACACCAGTCAGTAGGAGTGAA
GGCTCTAGGTAGGCACTAACCTACCTTGTTGTTGAATGAGTTATTTANATATTGCCTCCAGCAATAGGATATTACTGTCA
GTTTGTGAAGAGCAAACAGTAAGTAGCTTCAGTAATATATTCTGGCTGTTGGGGTTCTATAGAGCTCCTTTAACAAGAAC
TTTAGATGTAATGCATTTCAAAGATTGGATGTCTCATTTGATGATGAGAGATGTCTACTTGGACTTGGTCTCCCTGTTAT
TTAGTGACTCCATTTATATTTCTTTCATATATGNATATATTTTGTGACTACTTCTACTATAGTAGGTTTCTTTCCATACT
ATTCCTCAAGTGACCCTGAGTTTTAGCTGTTTCTCCTCTTATTCCCTCTCTATTCTCCCTGACTTTCCCCTTTTT
Sequence Type genomic DNA
Unitrap ID UNI4770

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 10428891..10429586 665
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000062078 (Qk) NM_021881 quaking Gene [Source:MGI Symbol;Acc:MGI:97837]

 
Come back to gene ENSMUSG00000062078


For any suggestions or comments, please send an email to unitrap@crg.es