Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14819F6
Clone ID IST14819F6
Vector VICTR76
Project tigm

Sequence tag IST14819F6HMR1
Sequence
NGGTGATNAANAAGAGACCAGCATCATTGAGGTGACATCTTCTGGGAAGTGTTTTCTGAAAGCACAAAGAGGCAGTGTTC
CAGAGAT
Sequence Type genomic DNA
Unitrap ID UNI31324 UNI31325

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 11030027..11030112 82
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 46190605..46190690 82
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 24557635..24557720 82
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 102668191..102668276 82
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 97762895..97762980 82
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035158 (Mitf) NM_008601 microphthalmia-associated transcription factor Gene [Source:MGI (curated);Acc:Mitf-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 87489765..87489850 82
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 70032936..70033021 82
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039298 (Cdk5rap2) NM_145990 CDK5 regulatory subunit associated protein 2 Gene [Source:MGI (curated);Acc:Cdk5rap2-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 31240496..31240581 82
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 74203031..74203116 82
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 151983798..151983883 82
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 193695083..193695168 82
NO GENE  


Sequence tag IST14819F6HMF1
Sequence
CGCTAATTTCTTAGCTCCAGCTAACCAGCATCAATAGTCCCAGTAATGCAAAGTTTTTGCTTTGGTAGTTCTGGTATCTT
GTTAATCACAGCTGATTCTTCAGCCCCAGCTAACCAGAACTACAGAATCTTCACAAACAAAACAGCAATGGCCCTGAAAA
GAGTCTTTAATTTTTCCTCTGAAATTTCACAAACCAGAGCTCCATCTTCTGCAGTGTTCTCAACATTATCTTCCAAGCTC
CTACATGACATCCGACAGAGCTCTTAACAACGGATGGATCTTCAAGCCCAAAGTTCCAAAGTCCTTCCACAGTCCTCCCC
AAAACATGGTCAGATTGTCACAGGAATACCCCACTCTGCTGGTACCAATTTGTCTTANTCAGGGTTTCTATTCCTGCACA
AACATCATGACNAAGAAGCAAGTTGGGGAGGAAAGGGTTTATTCNGCTTACACTTCCATACTGCTGTTCNTCACCANNNA
NCCNNGACTGGAANTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 193695168..193695661 470
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 58087352..58087845 470
 
EST/CDNA Est Name
  AW122194.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 151983883..151984376 470
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 125778455..125778948 470
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 102668276..102668769 470
NO GENE  

 
Come back to gene AW122194.1


For any suggestions or comments, please send an email to unitrap@crg.es