Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14755B11
Clone ID IST14755B11
Vector VICTR76
Project tigm

Sequence tag IST14755B11HMR1
Sequence
CTACCTTTTTANAGGTTAAAAGTTGAGGTATATGTGAAATCTGGTGTCACTCCCAGAAATGATAGGGATACTGTGTCTGC
CCTAGTTACAGAGACCTAGCAAGGATGCTGTTTGATACTTTANCTGCCTTCTGGCTCCGGCTCCGCCTTTTTGAGACAAA
GTCCCATTTAGCACAGGAAGCCTTGAACTCCCTATATGGCTGAGCCAN
Sequence Type genomic DNA
Unitrap ID UNI7391

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 106673923..106674129 203
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040661 (Rad54l2) NM_030730 Rad54 like 2 (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1933196]


Sequence tag IST14755B11BBF1
Sequence
GTAGTACTCCTACCACAGGGCATGAGCTCTTTGGTGTCAGAGACCTGAATTAATGACACCCTTTCCTGTAGCATAGTACC
TTTCTTCTCATATGTACAAATGAATAATGAAACCTACAACCCCAGACTGTGAGAACTCACACAGCGCATGACTCAGCAAC
ATAATACAAAATGCAATGACCTANCACAACACAAACAACTACAGGGCTGTGTCACTCANGAAAACACACATTATAAACTG
GGCATCANCTCACTTGANAGTCCCGTGGAGGTGACAGCTTANTCCACACCATGTTGGTTTTCTCANGANAACCNATGTCC
CANTTNANGATAACCNGCTTTTATTTCCNTTANNTGGATGACNANNNNNNGCATGTGCNGTCNANNTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000040661


For any suggestions or comments, please send an email to unitrap@crg.es