Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14494D2
Clone ID IST14494D2
Vector VICTR74
Project tigm

Sequence tag IST14494D2HMR1
Sequence
CCNCTAAGCCNTCTCTCCAGTCCTTTCAACCTCCATTTGACATTAGGAAAATAATATCTCCCGGANAGTAGCTTTCATTC
TCAGAACCAACACAGAGGTTC
Sequence Type genomic DNA
Unitrap ID UNI20164

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 74441430..74441529 94
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000069814 (E130309D14Rik) NM_001013784 RIKEN cDNA E130309D14 gene Gene [Source:MGI Symbol;Acc:MGI:3588240]


Sequence tag IST14494D2HMF1
Sequence
GTGGTTTACAGCATCTGCTGTTCTTCCAGGGCACCTGGATTCCTTCACTTCCCAGCACCTACACGGCAGCTCAAGAGTAC
ACAGACATACATGCAGGCAAAATAAAATTAAAATGTCTTAGTGAGTAAATGTACTAGCAGTCCTAGAATACCTGTGAGAA
TTAAAGGAGACAAGAAATGTGAAGTACTAGTAGTAGTGCATGACCACTGTAATCCTAGACTCAGGGAGGCAGAGGTAGGA
GGGTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 74441190..74441433 244
 
EST/CDNA Est Name
  CJ123838.1

 
Come back to gene CJ123838.1


For any suggestions or comments, please send an email to unitrap@crg.es