Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14369G6
Clone ID IST14369G6
Vector VICTR74
Project tigm

Sequence tag IST14369G6HMR1
Sequence
GACCTGAGCTCAGGTCCTTTGCAAGACTANCTAACTCTCCAGCCCTCTGGAAAGGCATCTTTTTTTTTTTTTTCCNNTTN
NTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI14300

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 121254047..121254119 71
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032536 (Trak1) NM_175114 trafficking protein, kinesin binding 1 Gene [Source:MGI Symbol;Acc:MGI:1914345]


Sequence tag IST14369G6HMF1
Sequence
TTTACCAANAANACACACAGCAAANCCAGCATCCATTGAGAACATGTGCAACAACCTAAGTCATTAAGGACTGTAACTTT
AAATAACAGTGAGATTCGGCTAAAACTGANAAGACTAAAACCGCCAAATTCTGGTAGGAGCATGTGACCATCCTGCCTCT
GCCTCCCGTCAGACTTGGTCCGTTTTGTGGGTTTTATTATCTGCATGGCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 143113053..143113262 202
NO GENE  


Sequence tag IST14369G6BBF1
Sequence
GTCCCAGCACCCACATCAGGCAGATCACCTGCAACTCCAGCTACAGTGGGTCTTCTGGCTTCTGTGGCGCTGCATTCATG
TGCAAGCAAGCACATACAGACATAAATAAAAATAAAAACTAAGTCTTAAAGACTTCATCCTGCTGTTCTCACTTTCTCCC
TTANGAAATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 121253879..121254049 167
NO GENE  

 
Come back to gene ENSMUSG00000032536


For any suggestions or comments, please send an email to unitrap@crg.es