Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P129F01
Clone ID P129F01
Vector ROSAbetageo0
Project ggtc

Sequence tag P129F01
Sequence
TTCTGCTCTTTGACGCTGCCGAGGAAGCATCGCTGAAGGCTCTCGTAACTCTACCGTCATGTCTAAGTCCGAG
Sequence Type mRNA
Unitrap ID UNI10804 UNI10848

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 103070887..103070959 73
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000046434 (Hnrnpa1) NM_010447 heterogeneous nuclear ribonucleoprotein A1 Gene [Source:MGI Symbol;Acc:MGI:104820]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 123599296..123599368 73
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000058922 (AC165425.2)  

 
Come back to gene ENSMUSG00000058922


For any suggestions or comments, please send an email to unitrap@crg.es