Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10033H3
Clone ID IST10033H3
Vector VICTR75
Project tigm

Sequence tag IST10033H3HMR1
Sequence
CTCTCACCGCCTGTGGCTTCAGCCTGCTTCCCATCCTGCGCTCTGAGAGGAGCTGAAGCCTCTTCTTAACTTCCAGGCGC
CCAGGCTAACTTTTTTATTTTGTTAGCTTTGACCACGGTGTCATGGTGTCCAACCTATAAATAAAAACTAAAGATAAACC
CTGGGCTCTCGAATAAGAAAACTATTTTGACATTTCGAAGTCATCTGGGAACAAGGGAGCTAACTACAGGTTCTGGTTTG
GATTGAACTGACGGGAGAGATTATCTCAGCACTGCTTTGGGGGCTCAGGGTCTTCTTTGGGAGGTCCCCTCTCTGAACAA
ATTAAAGGTCAGGGAACAAATC
Sequence Type genomic DNA
Unitrap ID UNI29636

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 57291484..57291824 341
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038764 (Ptpn3) NP_035337 protein tyrosine phosphatase, non-receptor type 3 Gene [Source:MGI (curated);Acc:Ptpn3-001]


Sequence tag IST10033H3BBR1
Sequence
TCTCACCGCCTGTGGCTTCAGCCTGCTTCCCATCCTGCGCTCTGAGAGGAGCTGAAGCCTCTTCTTAACTTCCAGGCGCC
CAGGCTAACTTTTTTATTTTGTTAGCTTTGACCACGGTGTCATGGTGTCCAACCTATAAATAAAAACTAAAGATAAACCC
TGGGCTCTCGAATAAGAAAACTATTTTGACATTTCGAAGTCATCTGGGAACAAGGGAGCTAACTACAGGTTCTGGTTTGG
ATTGAACTGACGGGAGAGATTATCTCAGCACTGCTTTGGGGGCTCAGGGTCTTCTTTGGGAGGTCCCCTCTCTGAACAAA
TTAAAGGTCAGGGAACAAATGAGCCAATTCTGCGGTTGTGGTCTTGGAGCATGAGGATTGGTGGTGCAAGAGAAGATGGT
AGAGTTTTGTGAAAGTCAAGACTGATTGCTAAGTCTTAAGTGCACTTCTGATGAAAAGGATCCG
Sequence Type genomic DNA
Unitrap ID UNI29636

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 57291361..57291823 463
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038764 (Ptpn3) NP_035337 protein tyrosine phosphatase, non-receptor type 3 Gene [Source:MGI (curated);Acc:Ptpn3-001]


Sequence tag IST10033H3HMF1
Sequence
AGAGGTGGCCTATAAACCGCTATAAAAAAAAGCGAAACAGGCTCCAGCCCTCCGGGCCTCAGCTACCTTCAATACTTCTG
CCTCGGGGAAGAGGAAGCCAGGCCCAGCACAGGAAGGTGGCAGCCCTGGGTAGGTATGAGAAGCCTTTATCCTGGGGTAT
CACACAGGGCAAAGGCAACCAAAACTACCCAGGTCCCGAGTCCTCCCTCGTGTGACTCCTCTCCCCAGCTGATACCAGTT
GAAGACAAGATTTTTATTAGTTATTTTAATGTTTGGGAAGATGTCATCAAGCCTTCAAGTAATCCCCAAATTCCGGCCTT
CTACGAGGGTATTTTCGGTAGCCCCACCCCCTGCCCCAGGACCTGTAGATCTTGTTTATAATTACTTTTGGCTTCCTTTG
TTATTACTTTGGCAAAGGAGTTCCGGCCCATTGACTCAATATTCATTTACTTGGCCCCAGGCCAAGCCAGGAAGTGGCCA
GT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 57291821..57292301 481
 
EST/CDNA Est Name
  CJ066835.1 - BB662384.1 - BY351393.1 - BY351531.1 - BB871784.1 - BY350486.1 - BY352327.1 - BY349020.1 - BB869375.1 - CJ129901.1 - BY352340.1 - BY347642.1 - BB873140.1 - BY773772.1 - BY134918.1

 
Come back to gene CJ066835.1 - BB662384.1 - BY351393.1 - BY351531.1 - BB871784.1 - BY350486.1 - BY352327.1 - BY349020.1 - BB869375.1 - CJ129901.1 - BY352340.1 - BY347642.1 - BB873140.1 - BY773772.1 - BY134918.1


For any suggestions or comments, please send an email to unitrap@crg.es