Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10253B3
Clone ID IST10253B3
Vector VICTR76
Project tigm

Sequence tag IST10253B3HMF1
Sequence
CAGGACAGCCAGGGCTACACAGAGAAACCCTGTCTCAAAAAACCCA
Sequence Type genomic DNA
Unitrap ID UNI31336 UNI31337

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 74629633..74629678 46
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 103415978..103416023 46
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042757 (Tmem108) NM_178638 transmembrane protein 108 Gene [Source:MGI Symbol;Acc:MGI:1932411]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 20721118..20721163 46
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 66444946..66444991 46
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 28035913..28035958 46
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 93225983..93226028 46
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 52820747..52820792 46
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 147572903..147572948 46
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029640 (Usp12) NM_011669 ubiquitin specific peptidase 12 Gene [Source:MGI (curated);Acc:Usp12-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 132273042..132273087 46
NO GENE  


Sequence tag IST10253B3BBF1
Sequence
CAGGACAGCCAGGGCTACAAAGTGAGTTCNAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAG
AANGANNGAAAGAAAGAGGAGGTGGATTGTAGGCTCAAAGCTGAAAGCTGAAACCCAAATAGCTANGANAGGTGTAAGCC
CCTACAGGCAAGACAGGCAGGTGAGTGGTCACATCTCTCCTGAGGTCCCCCNAANGCCNNGCCCCACCCAAAGGACAGTC
TANCTGCCCTAANCAGNGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000029640


For any suggestions or comments, please send an email to unitrap@crg.es