Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P134B06
Clone ID P134B06
Vector ROSAbetageo0
Project ggtc

Sequence tag P134B06
Sequence
CTGAGTGAGTCTCTGCTGTCCGGAATTCTCTGGTTTTCTTCGCAGGCAGTGTTCTGCCCACTGGCCCACCACCTCAGGGG
AACGATGGCCACAGAGTCTACAGCCGCTGCTGCCATCNNNGCGGAGCTGGTTTCCGCTGACAA
Sequence Type mRNA
Unitrap ID UNI1110

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 116299937..116300079 137
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028693 (Nasp) NM_016777 nuclear autoantigenic sperm protein (histone-binding) Gene [Source:MGI (curated);Acc:Nasp-001]


SPLK-Sequence tag 3SP134B06
Sequence
CAGATATGGCTAAAGAGCTTTCCCTATGTGCACTCTGCTATACAGGCANNCTTGTTCCCCTTCTCACATCTTAGCACACA
AGGATCAGAAAGGCTTTAAAACATCATTAGACATTTCTTTATT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000028693


For any suggestions or comments, please send an email to unitrap@crg.es