Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14099G12
Clone ID IST14099G12
Vector VICTR74
Project tigm

Sequence tag IST14099G12HMF1
Sequence
AGTGTACTTACATATAACAATAAATAAATCTTTA
Sequence Type genomic DNA
Unitrap ID UNI31346 UNI31347 UNI31348 UNI31349 UNI31350

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 12780100..12780133 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024694 (Keg1) NM_029550 kidney expressed gene 1 Gene [Source:MGI (curated);Acc:Keg1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 6622857..6622890 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039540 (4921524L21Rik) RIKEN cDNA 4921524L21 gene Gene [Source:MGI Symbol;Acc:MGI:1918151]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 26387982..26388015 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 22272130..22272163 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 36145305..36145338 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037617 (Spag1) NM_012031 sperm associated antigen 1 Gene [Source:MGI Symbol;Acc:MGI:1349387]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 57741316..57741349 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 74488408..74488441 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000056359 (D830013O20Rik) RIKEN cDNA D830013O20 gene Gene [Source:MGI Symbol;Acc:MGI:2685737]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 3868944..3868977 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 14953414..14953447 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 27454530..27454563 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 42124394..42124427 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038302 (Lace1) NM_145743 lactation elevated 1 Gene [Source:MGI (curated);Acc:Lace1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 13218449..13218482 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 29922786..29922819 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 52635211..52635244 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 89837319..89837352 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 3351003..3351036 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 47490978..47491011 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 39766674..39766707 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 11559659..11559692 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 22399287..22399320 34
NO GENE  


Sequence tag IST14099G12HMR1
Sequence
GCTNCAGCAAGGCTGCCCTGAGGTGCCCTTGGACCNTCTCCTGAGATTAACTCTGCGAAGAGCTGTAATCACTGCCTCCT
AACGACTGGGTACACAGAGAGCAACAACTGAGAGCAGATCACCAAGAAGTGACAGGCTTGCTGGAGGGGTGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 136369110..136369261 148
NO GENE  

 
Come back to gene ENSMUSG00000038302


For any suggestions or comments, please send an email to unitrap@crg.es