Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13566F7
Clone ID IST13566F7
Vector VICTR74
Project tigm

Sequence tag IST13566F7HMR1
Sequence
ACTCCAGTGGAGTGAGACACCAACATAAACACAGACAGAGTCTCAGGCGTGTGTTAGCACATTGCCCATGCATGCAAATA
GGAGCTAACCAGTCTTCTGAGGGCTTTTACTCTGGCGGGGGGCCCAGACTGGTACCGCAGCCCAGAGGGGCTGTTTAGAC
AGCTGTAGAGGCCACAAAAGAGCTGCCTGTTGCCCTGTGGTGGGTGTAGAGTCCCTGTAGGTCTGGGACTGGGGAGGGAA
GCCTGGTTATTTCTGTTCTTGTTGTCAATACTAAGAGN
Sequence Type genomic DNA
Unitrap ID UNI31351

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 108982514..108982790 273
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032737 (Inppl1) NM_010567 inositol polyphosphate phosphatase-like 1 Gene [Source:MGI Symbol;Acc:MGI:1333787]

 
Come back to gene ENSMUSG00000032737


For any suggestions or comments, please send an email to unitrap@crg.es