Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14794G11
Clone ID IST14794G11
Vector VICTR76
Project tigm

Sequence tag IST14794G11BBF1
Sequence
CATCCAGCCTCAAGTTCCCCCACCATCTAAGGCATCTGCACCATTTCACAGGTGCAAGAGGGAGGAAGAGTCAGGGGATG
CTCGGTGCTGCTCAGCATGAAAAATACCAAACAGGAAAGACTGATGGGATTCCAGTGCCGGTCCCACTGAAAGCACAGGC
TGAAGATGCAGAGAGAGAGACAGAGACACAGAGAGGGAGAGAGCACCCAAGCTATTGAGGTTTGAAATAAATGAATGCTT
CTACTCTGTGGGTGACAGAAGGAGCACCACACCCACCACAGCTGTTTACCAGACTGCAGGTCCCACTCCAAGAATCCCCA
ANGCAGGCTTGAAGGCAAAAACAAGTTCTCTGGGTATCAGGGACAGAAGTAAGACCAGAACTCCNGCCNGGCNATCTTTG
CTTCTCTGCANGANGTAAGGGGCCCAAGAAGCTANAACATTGCTCTGANANNGCAGANCCNANNGCNCTGTCNCCCTATG
GGTGACTCCTTTCTATACNNNCCCNCAN
Sequence Type genomic DNA
Unitrap ID UNI25435

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 26409525..26410031 467
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000007817 (Zmiz1) NM_183208 zinc finger, MIZ-type containing 1 Gene [Source:MGI Symbol;Acc:MGI:3040693]


Sequence tag IST14794G11HMF2
Sequence
TTCCTGTAGGTTGAAGATAATATCTGCTGGCATTTCTGTCTTTGAGGCTGGTAGAAGCTGGTTTTCTGCTAAATCTATAG
ATTCTAATCAAGAGGCTTTTTATCTACTATCACAAGCTGCTAGTTCTTACTTGGGGCAAGGAATGATTGCTCTAGAGGGC
CAGCACTTAGCCCAAGGTAATTAGCCTCTGGACCTGCAGCATTCCAATCTCCACAGTACTGAAGTTCTTATTAGCCAGTC
TCTGCAGACAGATTCCTGTCAAGTATTTTTATTTAGTTAGTATTAGAAATCTGTTAATTTCTCTGGCAAGACTCAGTATT
TTGGA
Sequence Type genomic DNA
Unitrap ID UNI9880

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 113736391..113736714 322
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000003316 (Glg1) NM_009149 golgi apparatus protein 1 Gene [Source:MGI Symbol;Acc:MGI:104967]

 
Come back to gene ENSMUSG00000003316


For any suggestions or comments, please send an email to unitrap@crg.es