Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P135B01
Clone ID P135B01
Vector ROSAbetageo0
Project ggtc

Sequence tag P135B01
Sequence
TCCCATATTGAACTCGAGTTGGAAGAGGCGAGTCCGGTCTCAAAATGGAG
Sequence Type mRNA
Unitrap ID UNI5036 UNI5037 UNI5038 UNI5039 UNI10782

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 145530316..145530365 50
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 8784182..8784231 50
 
EST/CDNA Est Name
  BC057655.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 94464949..94464998 50
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041929 (CT573086.9)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 75497331..75497380 50
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000059005 (Hnrpa3) NM_146130 heterogeneous nuclear ribonucleoprotein A3 Gene [Source:MGI (curated);Acc:Hnrpa3-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 54285344..54285393 50
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000069014 (AC121785.3)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 12159936..12159985 50
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060989 (AL805912.5)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 66639845..66639894 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 72929700..72929749 50
 
EST/CDNA Est Name
  BC057655.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114538903..114538952 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 77702034..77702083 50
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000067669 (AL844863.7)  

 
Come back to gene ENSMUSG00000067669


For any suggestions or comments, please send an email to unitrap@crg.es