Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P134H11
Clone ID P134H11
Vector ROSAbetageo0
Project ggtc

Sequence tag P134H11
Sequence
CTTTGACGCTGCCGAGGAAGCATCGCTGAAGGCTCTCGTAACTCNNNCGTCATGTCTAAGTCCGAGTCTCCCAAGGAGCC
AGAACAGCTGCGGAAGCTCTTCATCGGAGGGCTGAGCTTCGAAACAACCGACGAGAGTCTGAGGAGCCATTTTGAGCAAT
GGGGAACACTAACAGACTGTGTGGTAATGAGAGATCCAAACACCAAGAGATCCAGGGGCTTTGGGTTTGTCACATATGCC
TCTGTGGAAGAAGTGGATGCTGCCATGAATGCAAGNNNACACAAGGTGGATGGAAGAGTTGTGGAACCTAAGAGAGCTGT
CTCAAGAGAA
Sequence Type mRNA
Unitrap ID UNI10804

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 123599032..123599361 316
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000058922 (AC165425.2)  

 
Come back to gene ENSMUSG00000058922


For any suggestions or comments, please send an email to unitrap@crg.es