Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11547D8
Clone ID IST11547D8
Vector VICTR76
Project tigm

Sequence tag IST11547D8HMR1
Sequence
AAATNNTTCTCCACTCTCTGGAGTCCGGTGAGTGCCTGGCACCCGTGCCTTGCTCTCCTTGGGCCTCTAACAAAGAGGCC
TGCACTCAGCCAAGCCTCTCTCGGCCCAGGACAACCCANTCC
Sequence Type genomic DNA
Unitrap ID UNI29109

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95481357..95481477 115
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015850 (Adamtsl4) NM_144899 ADAMTS-like 4 Gene [Source:MGI (curated);Acc:Adamtsl4-001]


Sequence tag IST11547D8HMF1
Sequence
NGAGAAGTCACATTGAACTCGGCCCCCAGCTTGGACACACAGATAATGTCTCTGTGTTGTGTGCCANACCCACACTCCGA
GGAACACTGTAAGGGAGGGGAAGAGAGATCACTCTTAAGTTTAAAATGTGGGGCTTCGCCAGGACTGGTTTCCCTTCGGT
CCCGCATCTCANGGCCCCCANCTGACCTCACTCCAGGGGCCTGTGAACCNNCGCCATGTCCTCTCACANGGCCCTAAACT
GCAGGCACGCATATCGGGAGGGCGGCTTCTGANANGGCANCCCTGCTCANTGCTTCCTGCTTCCGGGTCTCCCTGAANGG
TCTCCCCACTCCTAANGCANANNNCAGCGCGTCTCTGGATTCCTGTCCCGCACTCNNNTNANCACTGTTGGGANGGAGAG
TGACCTATGTGTTGGGNNGTGANGAAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000015850


For any suggestions or comments, please send an email to unitrap@crg.es