Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13430H10
Clone ID IST13430H10
Vector VICTR74
Project tigm

Sequence tag IST13430H10BBF1
Sequence
CAGAGGTCCTGAGTTCAATTCTCANCAACCACATGGTGGCTCACAACCNTCTGTAATGGGATCNGT
Sequence Type genomic DNA
Unitrap ID UNI31356 UNI31357

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 9986991..9987053 59
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 27062923..27062985 59
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024301 (AC144621.3-201) NM_053173 kinesin family member C1 [Source:RefSeq peptide;Acc:NP_444403]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 30240363..30240425 59
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 12936712..12936774 59
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 34790872..34790934 59
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 112414315..112414377 59
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 20825410..20825472 59
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 31203345..31203407 59
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 126390934..126390996 59
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 88044329..88044391 59
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 113551965..113552027 59
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 20509815..20509877 59
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 37176710..37176772 59
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 148787556..148787618 59
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 12395633..12395695 59
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 28994135..28994197 59
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000043535 (Setx) NP_932150 senataxin Gene [Source:MGI (curated);Acc:Setx-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 120631633..120631695 59
NO GENE  


Sequence tag IST13430H10HMF1
Sequence
CAGAGGTCCTGAGTTCAATTCTCAGCAACCACATGGTGGCTCACAACCATCTGTAATGGGATCCAATACCCTCTTCTGCT
GTGTCTGAAGACAGCTACAGTGTACTCACATACATAGAATAAATAAAATCTTTAAGAACAGCAAAAAAGAAAAATCTGGA
CTAGAGATACTTANAAACCACATCCCTCCTCCTTTTTGTAAGACTTCCCTTTGAAGGGCCTTCCTCACTCTCTGCTCACG
TGGTAAAGTGGACCCCATCCNATGATGGCTCATGGTGCACATGATCCAGACCTGATCACTANTCTTTTCTGANATGAATA
TGACTTTAAAAGAGGAATGCCNAGACAGGAGATGGCTCAGTGGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 24275893..24276257 355
 
EST/CDNA Est Name
  CN688398.1 - BY032291.1 - CD552185.1 - BY060297.1 - BB867137.1 - BY075587.1 - BY073294.1

 
Come back to gene CN688398.1 - BY032291.1 - CD552185.1 - BY060297.1 - BB867137.1 - BY075587.1 - BY073294.1


For any suggestions or comments, please send an email to unitrap@crg.es