Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P136E09
Clone ID P136E09
Vector ROSAbetageo0
Project ggtc

Sequence tag P136E09
Sequence
TTTGTCCGGTTCGGCGGTCTTTCTGTGAGGGTGTTTCGACCGCCTGGGCGGTTTGTGCTTTCATCACATTTGTTAACAG
Sequence Type mRNA
Unitrap ID UNI10969

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 62365019..62365097 73
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019505 (Ubb) NM_011664 ubiquitin B Gene [Source:MGI (curated);Acc:Ubb-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 46703716..46703794 73
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000044285 (AC163692.4)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 5750819..5750897 73
 
EST/CDNA Est Name
  NM_011664.2 - AK013027.1 - AK165313.1 - AK010625.1 - AK132747.1

 
Come back to gene NM_011664.2 - AK013027.1 - AK165313.1 - AK010625.1 - AK132747.1


For any suggestions or comments, please send an email to unitrap@crg.es