Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13410C4
Clone ID IST13410C4
Vector VICTR74
Project tigm

Sequence tag IST13410C4BBF1
Sequence
TCAGCATCCTCCTCCTGCCTCTANACTAGGCATGTGACTTGAAGTAGTGTCAGGTGGTGTGCTCGGACTGGCCCGAGTGG
GTGTGGTGTGGTGGCTGATCACTCTCCTGTCAGCTGGCCCANCAGATGGAGGTGCTTGCCTCTAGGCNCANTGTTGGGAC
TGANTGAAATCCCAGGATCT
Sequence Type genomic DNA
Unitrap ID UNI10487

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 32017801..32017979 169
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039262 (5830434P21Rik) NM_172661 RIKEN cDNA 5830434P21 gene Gene [Source:MGI Symbol;Acc:MGI:1923304]


Sequence tag IST13410C4HMF1
Sequence
TCANCATCCTCCTCCTGCCTCTANACTANGCATGTGACTTGAAGTATTGTCAGGTGGTGTGCTCGGACTGGCCCGAGTGG
GTGTGGTGTGGTGNCTGATCACTCTCCTGTCAGCTGGCCCANCAAATGGAGGTGCTTGCCTCTAGGCNNNNTNTTGGGAC
TGANNNNNNNCCCNNGATCCATGGGATGGATGGATGGGTGGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000039262


For any suggestions or comments, please send an email to unitrap@crg.es