Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14556H9
Clone ID IST14556H9
Vector VICTR74
Project tigm

Sequence tag IST14556H9HMR1
Sequence
GTAAACTTTTCCTAGATTTATTTCTAATCTCTAGTTAGTGACATATTCTAGACTGGCAGGTAGCACAGTGGTCTTGTCCC
TGCCTGTTGGGCTCCTACAGGTGCTGAGCAAAGGTGTCAGCCCCTTTACTCAGCAGAGGTCCTACTTGAAAGACCAGCTT
TCTGTAGAATCAGCATGGTANAGTGACTCANCAATGGGAATGAANCCNTTGTGATATTTTACGTCTTTTANAGTANACAG
ATGGAATGAGCTTTGAAATGAANNTGANTTTCCTAATGGATTTTGTTTTTAAGGTAACTCGTGTATGAC
Sequence Type genomic DNA
Unitrap ID UNI22707

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 81845650..81845957 290
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035834 (Polr3g) NM_001081176 polymerase (RNA) III (DNA directed) polypeptide G Gene [Source:MGI Symbol;Acc:MGI:1914736]


Sequence tag IST14556H9HMF1
Sequence
CTTGATCNNAGGAATTAACTGGGAGATAAAAAATATAAATATAAAACATATTGAGTCCTGGGGAACACTTANTTCTCAAA
CCTAATAAGCCAACATCTTTGAAGTTGGGCCCTGGAAATGGTTTGGGAAATTCACTCTAAGAGTATCTGACTTAACACTG
TTTAATGGAATATTGTCCCANAAATAANCTCTGCAGACTCCAACTTCCTATTTTTATCTTGCAGTCATTGGGCATAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 81845966..81846202 227
 
EST/CDNA Est Name
  AA009266.1 - BY139864.1 - BY352353.1 - CN689335.1 - CD560133.1 - BY347262.1


Sequence tag IST14556H9BBF1
Sequence
GCTTGATCAGAGGAATTAACTGGGAGATAAAAAATATAAATATAAAACATATTGAGTCCTGGGGAACACTTAGTTCTCAA
ACCTAATAAGCCAACATCTTTGAAGTTGGGCCCTGGAAATGGTTTGGGAAATTCACTCTAAGAGTATCTGACTTAACACT
GTTTAATGGAATATTGTCCCAGAAATAAGCTCTGCAGACTCCAACTTCCTATTTTTATCTTGCAGTCATTGGGCATAAAC
TGATAACAACAGTAAATGTATCCGGCAGAGAATCCAATGCTAGCTTTTGAGACACATTGGTTACAAGGCGCACTGCCTAC
AAGCCATCCTACAGTTTGATGTCGCAGACAGGGTGCTCCCGTATATACNACACTTGGTTTCTTTTCTTTNNCTTTNTNTT
TTTNAAATTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 81845965..81846373 395
 
EST/CDNA Est Name
  CK335096.1 - BG800019.1 - CK332417.1 - BG143581.1 - CD552102.1 - CN674877.1 - CF165925.1 - CN674993.1 - CD564401.1 - BB858718.1 - BY032412.1 - BY295793.1 - BY308063.1 - BX524506.1 - AI158401.1 - AA204398.1 - BY052024.1 - AA009266.1 - BY139864.1 - BY352353

 
Come back to gene CK335096.1 - BG800019.1 - CK332417.1 - BG143581.1 - CD552102.1 - CN674877.1 - CF165925.1 - CN674993.1 - CD564401.1 - BB858718.1 - BY032412.1 - BY295793.1 - BY308063.1 - BX524506.1 - AI158401.1 - AA204398.1 - BY052024.1 - AA009266.1 - BY139864.1 - BY352353


For any suggestions or comments, please send an email to unitrap@crg.es